RNA ANALYSIS

Structural RNAs:

red_bullet.gif (914 bytes) tRNAs: tRNAscan-SE- (Univerisity of California at San Diego, U.S.A,) is incredibly sensitive & also provides secondary structure  diagrams of the tRNA molecules. It can also be accessed here or here . Alternatively use ARAGORN   (Reference: Laslett, D. & Canback. 2004. Nucleic Acids Research 32:11-16) or FindtRNA - (D. Paul & Md. Aftabuddin, West Bengal University of Technology, India) - identifies tRNA genes without introns or with introns at canonical or non-canonical positions.

red_bullet.gif (914 bytes) ARWEN - is a program to detect tRNAs in metazoan mitochondrial DNA sequences (Reference: D. Laslett & B. Canbäck B. 2008. Bioinformatics 24:172-175)

red_bullet.gif (914 bytes) Rfam - The Rfam database is a collection of RNA families, each represented by multiple sequence alignments, consensus secondary structures and covariance models (Reference: Gardner, P.P. et al. 2008. Nucl. Acids Res. 37, Database issue D136-D140)

red_bullet.gif (914 bytes) TFAM - unlike other tRNA gene-finders, TFAM uses information from the total sequences of tRNAs and not just their anticodons to predict their function. Therefore TFAM has an advantage in predicting initiator tRNAs, the amino acid charging identity of nonstandard tRNAs such as suppressors, and the former identity of pseudo-tRNAs. New TFAM models are available including a proteobacterial model for the bacterial lysylated isoleucine tRNAs, making it now possible for TFAM to correctly classify all tRNA genes for some bacterial taxa.(Reference: H.Tåquist et al. 2007. Nucleic Acids Res. 35 (suppl 2): W350-W353).

red_bullet.gif (914 bytes) Ribosomal RNA BLAST - BLASTN searches against the small (SSU) &/or large (LSU) subunit RNA databases Unfortunately the input is limited to a maximum of 10000 nucleotides.  This site has been superceded by GeoBLAST at Silva which provides a comprehensive, quality checked and regularly updated databases of aligned small (16S/18S, SSU) and large subunit (23S/28S, LSU) ribosomal RNA (rRNA) sequences for all three domains of life.


Test sequences .

Predicted tRNA Secondary Structures:

Your-seq.trna1 (1-74)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (35-37)	Score: 65.31
         *    |    *    |    *    |    *    |    *    |    *    |    *    |   
Seq: GGTCTCTTGGCCCAGTTGGTtAAGGCACCGTGCTAATAACGCGGGGAtCAGCGGTTCGATCCCGCTAGAGACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.

red_bullet.gif (914 bytes) TFAM - unlike tRNA gene-finders, TFAM uses information from the total sequences of tRNAs and not just their anticodons to predict their function. Therefore TFAM has an advantage in predicting initiator tRNAs, the amino acid charging identity of nonstandard tRNAs such as suppressors, and the former identity of pseudo-tRNAs (Reference: Tåquist,H. et al. 2007. Nucleic Acids Res. 2007 35(Web Server issue): W350–W353). It can also be accessed here.

red_bullet.gif (914 bytes) tmRNAs BRUCE - detects transfer-messenger RNAs which function to free ribosome-stalled mRNAs. (Reference: Laslett, D., et al. 2002.  Nucleic Acids Res. 30: 3449-3453, 2002) .

red_bullet.gif (914 bytes) Small nucleolar RNAs (snoRNAs) - can be detected with Snoscan for methylation-guide for snoRNAs and snoGPS for pseudouridylation-guide snoRNAs (Reference: P. Schattner et al. 2005. Nucl. Acids Res. 33: W686-W689). Test sequences.

red_bullet.gif (914 bytes) Mireval: a web tool for simple microRNA prediction (Reference: Ritchie, W. et al. 2008. Bioinformatics 24:1394-1396).

red_bullet.gif (914 bytes) RNAmmer 1.2 - predicts 5s/8s, 16s/18s, and 23s/28s ribosomal RNA in full genome sequences (Reference: Lagesen, K et al. 2007. Nucl. Acids Res. 35: 3100-3108)

red_bullet.gif (914 bytes) Ribosomal RNA BLAST (University of gent, Belgium) - BLASTN against the SSU (16S) and LSU (23S) rRNA databases;  and a quick phylogeny search.

RNA folding:

red_bullet.gif (914 bytes)  LocARNA - Multiple Alignment of RNAs -   is a tool for multiple alignment of RNA molecules. LocARNA requires only RNA sequences as input and will simultaneously fold and align the input sequences. LocARNA outputs a multiple alignment together with a consensus structure. For the folding it makes use of a very realistic energy model for RNAs as it is by RNAfold of the Vienna RNA package (or Zuker's mfold). For the alignment it features RIBOSUM-like similarity scoring and realistic gap cost.  ( Reference: C. Smith et al. 2010. Nucl. Acids Res.  38: W373-377).

red_bullet.gif (914 bytes) FOLDALIGN - folds and aligns RNA structures (make a foldalignment) based on a lightweight energy model and sequence similarity. The current version makes pairwise fold alignments. (Reference: J. H. Havgaard et al. 2005. Bioinformatics 21: 1815 - 1824). Also available here .

red_bullet.gif (914 bytes) For RNA folding use MFold (Michael Zuker, Rensselaer Polytechnic Institute, U.S.A.)N.B. The data can be presented in a number of graphic formats.
red_bullet.gif (914 bytes) Vienna RNA secondary structure prediction  (University of Vienna, Austria). I have found this site useful for drawing tRNAs in cloverleaf format.

red_bullet.gif (914 bytes) CONTRAfold is a novel secondary structure prediction method based on conditional log-linear models, a flexible class of probabilistic models which generalize upon stochastic context-free grammars by using discriminative training and feature-rich scoring. By incorporating most of the features found in typical thermodynamic models, CONTRAfold achieves the highest single sequence prediction accuracies to date, outperforming currently available probabilistic and physics-based techniques. It provides MARNA-like output couples with hairpin structures (Reference: Do, C.B. et al. 2006. Bioinformatics 22: e90-e98).

red_bullet.gif (914 bytes)  Radar (RNA Data Analysis and Research) - provides (1) constrained alignment of RNA secondary structures, and (2) prediction of the consensus structure for a set of RNA sequences. RADAR performs many important RNA mining operations, including understanding the functionality of RNA sequences, the detection of structural RNA motifs and the clustering of RNA molecules. (Reference: Khaladkar, M. et al. 2007. Nucl. Acids Res. 35: W300-W304)
 

Pseudoknots:

red_bullet.gif (914 bytes) Kinefold RNA/DNA folding predictions including pseudoknots and entangled helices. Provides (i) a series of low free energy structures, (ii) an online animated folding path and (iii) a programmable trajectory plot focusing on a few helices of interest to each user. (Reference: A. Xayaphoummine et al. 2005. Nucl. Acids Res. 33: W605-W6). Structure of GGGAGAUUCCGUUUUCAGUCGGGAAAAACUGAA is shown below:

red_bullet.gif (914 bytes) pknotsRG (Universität Bielefeld, Germany) - is a series of 3 tools for folding RNA secondary structures, including the class of simple recursive pseudoknots. Unfortunately to optimally view the results one needs Microsoft.NET framework (massive) and PseudoViewer(School of Computer Science and Engineering, Inha University, Korea).

red_bullet.gif (914 bytes) HPknotter: A Heuristic Approach for Detecting RNA H-type Pseudoknots - offers a variety of tools including pknotsRG, PNOTS and NUPACK (Reference: C.-H. Huang et al. 2005. Bioinformatics 21: 3501-3508).

red_bullet.gif (914 bytes) RNATOPS-W - a profile based RNA structure search program that can detect RNA pseudoknots in genomes.  For input it requires  a structure profile in the pasta format, and  genome sequences in the fasta format.

Ribosomal RNA analysis:

red_bullet.gif (914 bytes) Ribosomal RNA Analysis - The Ribosomal Database Project II (Michigan State University Centre for Microbial Ecology, U.S.A.). A tutorial is provided here.
red_bullet.gif (914 bytes) Ridom - Ribosomal RNA analysis for clinically relevant bacteria - (University of Würzburg, Germany)
red_bullet.gif (914 bytes) Rifle - (Universitat Bielefeld, Germany) The RIFLE system compares restriction patterns of 16S rDNA amplicons against a database of theoretical restriction patterns generated from a 16S rDNA database

Promoters, terminators and other regulatory elements:

PromScan (D.J. Studholme & R. Dixon. 2003. Domain architectures of sigma54-dependent transcriptional activators. J. Bacteriol. 185:1757-67; as modified by S. Richards, Queen's University, Canada). Scans small genomes for potential factor-binding sites including IHF-binding sites. If a *.ptt file is included the results will indicate the position of the promoter relative to the nearest gene.

Virtual Footprint - offers two types of analyses (a) Regulon Analysis - analysis of a whole prokaryotic genome with one regulator pattern and (b) Promoter analysis -  Analysis of a promoter region with several regulator patterns (Reference: R. Münch et al. 2005. Bioinformatics 2005 21: 4187-4189).

 WebGeSTer - Genome Scanner for Terminators - my favourite terminator search program is finally web enabled.  Please note that if you want to analyze data from a *.gbk file you need to use  their conversion program "GenBank2GeSTer" first. A complete description of each terminator including a diagram is produced by this program.  This site linked to an extensive database of transcriptional terminators in bacterial genome (WebGeSTer DB) (Reference: Mitra A. et al. 2011.  Nucl. Acids Res. 39(Database issue):D129-35).

 ARNold -  finds rho-independent terminators in nucleic acid sequences using two complementary programs, Erpin and RNAmotif. The program colors the terminator stem and loop (References: Gautheret D, Lambert A. 2001.  J Mol Biol. 313:1003–11 & Macke T. et al. 2001. Nucleic Acids Res. 29:4724–4735 ).

FindTerm (Softberry Inc.) - is one of only two tools on the internet for mapping rho-independent terminators. You might consider using the advanced feature options and minimally increase the default energy threshold to -12.0.
 TransTermHP (A. Villegas, Public Health Agency of Canada) an online version of TranstermHP, Reference: Kingsford, C. et al. 2007. Genome Biol. 8: R22) an updated version of TransTerm (Reference: Ermolaeva, M.D. et al. 2000. J Mol Biol301: 27-33)
RibEx: Riboswitch Explorer - scans <40kb DNA for potential genes (which are linked to BLASTP) and several hundred regulatory elements, including riboswitches. If you click on the "search for attenuators" it finds terminators and antiterminators. (Reference: C. Abreu-Goodger & E. Merino. 2005. Nucl. Acids Res. 33: W690-W692).

siRNA:

red_bullet.gif (914 bytes)  siRNA Target Designer (Promega, U.S.A.)  - Small interfering RNA (siRNA) guides sequence-specific degradation of the homologous mRNA, thus producing "knock-down" cells. Another similar program is   siRNA Target Finder (Ambion, U.S.A.).

siRNA Design Software - compares existing design tools, including those listed above. They also attempt to improve the MPI principles and existing tools by an algorithm that can filter ineffective siRNAs. The algorithm is based on some new observations on the secondary structure. (Reference: S. M. Yiu et al. (2004) Bioinformatics 21: 144-151).

red_bullet.gif (914 bytes) ARTS - Alignment of RNA Tertiary Structures - aligns two nucleic acid structures (RNAs or DNAs) in pdb format and detecting apriori unknown common substructures. The identified common substructures can be either large global folds or small local tertiary motifs with at least two successive base pairs. (Reference: O. Dror et al. 2005. Bioinformatics 21(suppl_2: ):ii47-ii53)